View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_114 (Length: 254)
Name: NF3237_low_114
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_114 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 45286831 - 45286614
Alignment:
| Q |
20 |
gtttgaaaattttgttgagggctgaaccttgttcttggtgttcttgnnnnnnnnn-ctttgcaattctaaaaataaaacacataataatcaaataattan |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45286831 |
gtttgaaaattttgttgagggctgaaccttgttcttggtgttcttgttttttctctctttgcaattctaaaaataaaacacataataatcaaataatt-- |
45286734 |
T |
 |
| Q |
119 |
nnnnnnnatttgaaaaatcaaattgatttgatattaatagagacgttataagaagggcaatttcaaaaatttatgttgataaagaagggttgttttgtaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45286733 |
-ttttttatttgaaaaatcaaattgatttgatattaatagagacgttataagaagggcaatttcaaaaatttatgttaataaagaagggttgttttgtaa |
45286635 |
T |
 |
| Q |
219 |
aaatgtcttgtccctcctatg |
239 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
45286634 |
aaatgtcttgtcactcctatg |
45286614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University