View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_126 (Length: 246)
Name: NF3237_low_126
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_126 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 30400536 - 30400296
Alignment:
| Q |
1 |
tcagcactttaatgacttatttatacttccaaaaatattaattcacgttgcttttgcctctcaaaatatctcacttcacttttgcctcacaaaagatctt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30400536 |
tcagcactttaatgacttatatatacttccaaaaatattaattcacgttgcttttgcctctcaaaatatctcacttcacttttgcctcacaaaagatctt |
30400437 |
T |
 |
| Q |
101 |
ttcgtttttcagaaaataaat--agtgaaattaaaagattggtttaaatggatataataaatttaagcattatccataccactctttgctcgtcttagtt |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30400436 |
ttcgtttttcagaaaataaatagagtgaaattaaaag-ttggtttaaatggatataataaatttaagcattatccataccgctctttgctcgtcttagtt |
30400338 |
T |
 |
| Q |
199 |
ttctagcgagagatactc-taactttcttttttctccttcat |
239 |
Q |
| |
|
||||||| | |||||| | ||||||| ||||||||||||||| |
|
|
| T |
30400337 |
ttctagccatagatacacttaacttttttttttctccttcat |
30400296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University