View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3237_low_130 (Length: 243)

Name: NF3237_low_130
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3237_low_130
NF3237_low_130
[»] chr2 (2 HSPs)
chr2 (15-132)||(44555154-44555266)
chr2 (176-220)||(44555068-44555112)


Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 15 - 132
Target Start/End: Complemental strand, 44555266 - 44555154
Alignment:
15 gaatatcaatgtcatgattcatgaggaactcnnnnnnnnnnnnnaacttatgttttctacttgtcaatgcctagtatcttgagatacctactaagattcc 114  Q
    |||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
44555266 gaatatcaatgtcatgattcatgaggaactc-----ttttttttaacttatgttttctacttgtcaatgcctagtatcttgagatatctactaagattcc 44555172  T
115 ttagcaaaagtaatgaat 132  Q
    ||||||||||||||||||    
44555171 ttagcaaaagtaatgaat 44555154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 220
Target Start/End: Complemental strand, 44555112 - 44555068
Alignment:
176 gtctttttgccactatatgttttttaaagtgaattttctttgtca 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
44555112 gtctttttgccactatatgttttttaaagtgaattttctttgtca 44555068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University