View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_131 (Length: 240)
Name: NF3237_low_131
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_131 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 54348196 - 54347993
Alignment:
| Q |
18 |
gaagaagatggagccggcaaggacgatggtgtaacggcgaccaatccagtcagaggttcggccagcgaggcaggaacctattaaggagaaaaggttgatg |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54348196 |
gaagaagatggagccagcaaggacgatggtgtaacggcgaccaatccagtcagaggttcggccggcgaggcaggaacctattaaggagaaaaggttgatg |
54348097 |
T |
 |
| Q |
118 |
atgcctactaggatttcaatttggacattagatagtttgaggtctctttttatgtatatcactgctccactcatcaccccaatatctgcataacataaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54348096 |
atgcctactaggatttcaatttggacattagatagtttgaggtctctttttatgtatatcactgctccactcatcaccccaatatctgcataacataaaa |
54347997 |
T |
 |
| Q |
218 |
taac |
221 |
Q |
| |
|
|||| |
|
|
| T |
54347996 |
taac |
54347993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 204
Target Start/End: Complemental strand, 26152768 - 26152712
Alignment:
| Q |
148 |
gatagtttgaggtctctttttatgtatatcactgctccactcatcaccccaatatct |
204 |
Q |
| |
|
|||| ||| ||||||||||||||||| || ||||||||||||| || ||||||||| |
|
|
| T |
26152768 |
gatactttaaggtctctttttatgtagattgctgctccactcataacaccaatatct |
26152712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 27318815 - 27318767
Alignment:
| Q |
157 |
aggtctctttttatgtatatcactgctccactcatcaccccaatatctg |
205 |
Q |
| |
|
|||||||||||||| || || |||||||||||||||| |||||||||| |
|
|
| T |
27318815 |
aggtctctttttatatagatggctgctccactcatcacaccaatatctg |
27318767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University