View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_133 (Length: 239)
Name: NF3237_low_133
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_133 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 30292958 - 30292738
Alignment:
| Q |
19 |
ttgttctgctatggtttcaggcttttggcatctttggcagctttgtctgcgtgaagcttcggttggttgtcctaatggtgcttcttgttttggtcaccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30292958 |
ttgttctgctatggtttcaggcttttggcatctttggcagctttgtctgcgtgaagcttcggttggttgtcctaatggtgcttcttgttttggtcaccaa |
30292859 |
T |
|
| Q |
119 |
gtggtggattgttgttgttcctttggcctgtattgatttctgtactgcagttgtatttctatggcctgtcttgtcttttctcttatcttggattcatctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30292858 |
gtggtggattgttgttgttcctttggcctgtattgatttctgtactgcagttgtatttctatggcctgtcttgtcttttctcttatcttggattcatctt |
30292759 |
T |
|
| Q |
219 |
gtgctttgataagagggtttt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30292758 |
gtgctttgataagagggtttt |
30292738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 94 - 146
Target Start/End: Complemental strand, 30287712 - 30287660
Alignment:
| Q |
94 |
tggtgcttcttgttttggtcaccaagtggtggattgttgttgttcctttggcc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30287712 |
tggtgcttcttgttttggtcaccaagtggtggattgttgttgtggctttggcc |
30287660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University