View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_134 (Length: 238)
Name: NF3237_low_134
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_134 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 30 - 218
Target Start/End: Original strand, 41731749 - 41731937
Alignment:
| Q |
30 |
aaatacactatacaattttattgtatttgtctctgtcattttatttgttagataatatttggtccctatcattttaacactagagttttataacaaaaat |
129 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41731749 |
aaatacaccatacaattttattgtatttgtctctgtcattttatttgttagaaaatatttggtccctatcattttaacactagagttttataacaaaaat |
41731848 |
T |
|
| Q |
130 |
agtcatttctnnnnnnnnnnnnnnnnnttatttcgatgtttgatctaatcgataagtttattcatatcttacaagtgtatgagtttaac |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
41731849 |
agtcatttctaaaaagaaagaaaaaagttatttcgatgtttgatctaatcgataagtttattcatatcttccaagtgtatgggtttaac |
41731937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 30 - 137
Target Start/End: Original strand, 41730605 - 41730710
Alignment:
| Q |
30 |
aaatacactatacaattttattgtatttgtctctgtcattttatttgttagataatatttggtccctatcattttaacactagagttttataacaaaaat |
129 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
41730605 |
aaatacactatacaattttattttatttgtccctgtcattttattttt--gataatatttggtccctatcattttaacactagagttttctatgaaaaat |
41730702 |
T |
|
| Q |
130 |
agtcattt |
137 |
Q |
| |
|
|||||||| |
|
|
| T |
41730703 |
agtcattt |
41730710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University