View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_145 (Length: 219)
Name: NF3237_low_145
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_145 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 28278000 - 28277820
Alignment:
| Q |
17 |
taggcagacaacaataccatcatcaggatgaaaactagaaattttgaagtgtactgaattagtaggaaaaatgaagaaaataaatgagaggaagaagaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28278000 |
taggcagacaacaataccatcatcaggatgaaaactagaaattttgaagtgtactgaattagtaggaaaaatgaagaaaataaatgagaggaagaagaga |
28277901 |
T |
 |
| Q |
117 |
ggaaacatatagaaattgggaggcatgcttagagttgtgaagaaatcagaaacgataagcttggacattgcatcaatgacc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28277900 |
ggaaacatatagaaattgggaggcatgcttagagttgtgaagaaatcagaaacgataagcttggacattgcgtcaatgacc |
28277820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University