View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_150 (Length: 210)
Name: NF3237_low_150
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_150 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 52 - 194
Target Start/End: Original strand, 53031414 - 53031556
Alignment:
| Q |
52 |
caaacaccgtcaaaagcggccctttcgtttccgacctgtgtacttggtatctagagggacatcgtttcctcttcttctcatttgatccttcttcctcagt |
151 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53031414 |
caaacactgtcaaaagcggccctttcgtttccgacctgtgtacttggtatctagagggacatcgtttcctcttcttctcatttgatccttcttcctcagt |
53031513 |
T |
 |
| Q |
152 |
atccattcctttcccttgccgctcttattattctttctctgct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53031514 |
atccattcctttcccttgccgctcttattattctttctctgct |
53031556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 77 - 183
Target Start/End: Complemental strand, 1021203 - 1021097
Alignment:
| Q |
77 |
cgtttccgacctgtgtacttggtatctagagggacatcgtttcctcttcttctcatttgatccttcttcctcagtatccattcctttcccttgccgctct |
176 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||| | ||||||||||||||| || |||||||||||| |||||||||| | ||||| | |||| |
|
|
| T |
1021203 |
cgtttccgaccagtgtacttggtatctggaggaacatcatctcctcttcttctcatctgctccttcttcctctttatccattccctgcccttttcactct |
1021104 |
T |
 |
| Q |
177 |
tattatt |
183 |
Q |
| |
|
||||||| |
|
|
| T |
1021103 |
tattatt |
1021097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University