View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3237_low_151 (Length: 208)

Name: NF3237_low_151
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3237_low_151
NF3237_low_151
[»] chr8 (1 HSPs)
chr8 (98-171)||(31798787-31798862)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 98 - 171
Target Start/End: Complemental strand, 31798862 - 31798787
Alignment:
98 aattgattttaattgctagttcgattgctcagtagaacaattcttgcaaga--ttttgtttatataattcaagtag 171  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||  |||| ||||||||||||||||||    
31798862 aattgattttaattactagttcgattgctcagtagaacaattcttgcaagattttttttttatataattcaagtag 31798787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University