View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_53 (Length: 378)
Name: NF3237_low_53
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 4e-88; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 151 - 361
Target Start/End: Original strand, 36919016 - 36919222
Alignment:
| Q |
151 |
gaattaggtggaaaaatgaaattgatcttcaattataattaatgtttttgaccatagaattagaggagatatttcatgttattggatctgaaatttttca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36919016 |
gaattaggtggaaaaatgaaattgatcttcaattataat----gtttttgaccatagaattagaggagatatttcatgttattggatctgaaatttttca |
36919111 |
T |
|
| Q |
251 |
gtctcttttaannnnnnnaactagtagatcaaaaggctaatcaatttaggaggaaattatagagtgtgggtgtgagtagcactcacgacgaattggagga |
350 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36919112 |
gtttcttttaatttttttaactagtagatcaaaaggctaatcaatttagaaggaaattatagagtgtgggtgtgagtagcactcacgacgaattggagga |
36919211 |
T |
|
| Q |
351 |
gtcctaggttg |
361 |
Q |
| |
|
||||||||||| |
|
|
| T |
36919212 |
gtcctaggttg |
36919222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 10 - 71
Target Start/End: Original strand, 36918820 - 36918881
Alignment:
| Q |
10 |
agatgaagagtatgaactaaattaaagtgacaaatttcatatacttaaaaattaaaacttct |
71 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36918820 |
agatgaagagtatggactaaattaaagtgacaaatttcatatacttaaaaattaaaacttct |
36918881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 107 - 143
Target Start/End: Original strand, 36918917 - 36918953
Alignment:
| Q |
107 |
aggatttaagttggaaagagtgatatttgagagagcc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36918917 |
aggatttaagttggaaagagtgatatttgagagagcc |
36918953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University