View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_68 (Length: 341)
Name: NF3237_low_68
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 7499877 - 7499702
Alignment:
| Q |
18 |
atttgatctatttcggctgctgagnnnnnnnntaatgggaaaaattattcttcaataacagttcttaagtttctgtggctctgaagtctgatctaattgt |
117 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7499877 |
atttgatctatttcggctgctaagaaaaaaaataatgggaaaaattattcttcaataacagttctaaagtttctgtggctctgaagtctgatctaattgt |
7499778 |
T |
|
| Q |
118 |
ttatatatggcactatctgttaatacatggctggctttagaatgatgtctcagttttttatgtttcttgatcatgaa |
194 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7499777 |
ttatatat-gcactatctgttaatacatggctggttttagaatgatgtctcagttttttatgtttctagatcatgaa |
7499702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 193 - 298
Target Start/End: Complemental strand, 7488416 - 7488311
Alignment:
| Q |
193 |
aacatgtctgatagccatagtctcatgattctttataaaacaataccctatgtaacccttctctcatgtgacaacgtaacacacatcaaacccttctttt |
292 |
Q |
| |
|
|||||||||||||| | || ||||||||| ||| || |||||| |||||||||||| |||||||||||| ||| ||||| |||||||||| || |||||| |
|
|
| T |
7488416 |
aacatgtctgatagtcctaatctcatgatccttcatgaaacaaaaccctatgtaactcttctctcatgtcacaccgtaatacacatcaaatccctctttt |
7488317 |
T |
|
| Q |
293 |
ccaaca |
298 |
Q |
| |
|
|||||| |
|
|
| T |
7488316 |
ccaaca |
7488311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 50 - 174
Target Start/End: Original strand, 8139017 - 8139134
Alignment:
| Q |
50 |
taatgggaaaaattattcttcaataacagttcttaagtttctgtggctctgaagtctgatctaattg-tttatatatggcactatctgttaatacatggc |
148 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| ||| ||||||||| ||||| ||| |||||||| ||||||||||||| |
|
|
| T |
8139017 |
taatgggaaaaattattcttccgtaacagttctaaagtttctgtggc-------tctcatctaattgttttatgtat-gcactatcagttaatacatggc |
8139108 |
T |
|
| Q |
149 |
tggctttagaatgatgtctcagtttt |
174 |
Q |
| |
|
|| |||| |||| ||||||||||||| |
|
|
| T |
8139109 |
tgactttggaattatgtctcagtttt |
8139134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 241 - 299
Target Start/End: Original strand, 6943675 - 6943733
Alignment:
| Q |
241 |
tatgtaacccttctctcatgtgacaacgtaacacacatcaaacccttcttttccaacaa |
299 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||| || |||||||||||| |
|
|
| T |
6943675 |
tatgtaacccttctctcatgtgacaacctaatacacatcaaatcccccttttccaacaa |
6943733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 191
Target Start/End: Original strand, 8139168 - 8139198
Alignment:
| Q |
161 |
gatgtctcagttttttatgtttcttgatcat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8139168 |
gatgtctcagttttttatgtttcttgatcat |
8139198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University