View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_82 (Length: 303)
Name: NF3237_low_82
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 298
Target Start/End: Complemental strand, 35608398 - 35608118
Alignment:
| Q |
19 |
ggtgaagaaagatttttctgttctcttctttctctttttatttatctataaacccttgttgctttggatctggttttagatctttctaagagtaagatag |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35608398 |
ggtgaagaaatatttttctgttctcttctttctctttttatttatctataaacccttgttgctttggatctggttttagatctttctaagagtaagatag |
35608299 |
T |
 |
| Q |
119 |
atagatc-attttttatgaatatgcagcaaagactagggtttattagctagnnnnnnncgaaagacgcgactattcttatnnnnnnngggacagtgttaa |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35608298 |
atagatctattttttatgaatatgcagcaaagactagggtttattagctagaaaaaaacgaaagacgcgactattcttataaaaaaagggacagtgttaa |
35608199 |
T |
 |
| Q |
218 |
taactattaaacaaacatataatatatgtaggttatactatatgatgcagattgaagagaaagagagattaaatgtctgtg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35608198 |
taactattaaacaaacatataatatatgtaggttatacgatatgatgcagattgcagagaaagagagattaaatgtctgtg |
35608118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University