View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3237_low_94 (Length: 279)
Name: NF3237_low_94
Description: NF3237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3237_low_94 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 34630283 - 34630010
Alignment:
| Q |
1 |
tcccagttggcaataataatgcagtggtatgtatccaagcacatccactcatttcacttgcacttggaatgaggaaataaacttcacgtgtttgcccgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630283 |
tcccagttggcaataataatgcagtggtatgtatccaagcacatccactcatttcacttgcacttggaatgaggaaataaacttcacgtgtttgcccgca |
34630184 |
T |
|
| Q |
101 |
ccatgtgattgtgctgttttgtttagtacacctcaaacctgaacatgtcacacccacaatcatcatggcttttgtattgcctatctataattttcatcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34630183 |
ccatgtgattgtgctgttttgtttagtacacctcaaacctgaacatgtcacacccacaatcatcatggcttttgtattgcctatctataattgacatcta |
34630084 |
T |
|
| Q |
201 |
acatatatttcaaagttcatgctagattgaactaaaattcattaagtaattattgtgtatggttttcatctcac |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
34630083 |
acatatatttcaaagttcatgctagattgaactaaaattcataaagtaattattgtgtatggttttcatgtcac |
34630010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University