View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3238_high_21 (Length: 366)
Name: NF3238_high_21
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3238_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 9e-89; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 176 - 349
Target Start/End: Complemental strand, 28466381 - 28466208
Alignment:
| Q |
176 |
cattggttaatgatgatattaatatttcatgagcatgtgatgatgaaaccaacctggtttctgaaaccatggtttggatttggagctttgaattggtggc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28466381 |
cattggttaatgatgatattaatatttcatgagcatgtgatgataaaaccaacctggtttctgaaaccatggtttggatttggagctttgaatttgtggc |
28466282 |
T |
 |
| Q |
276 |
attgaagaagagaatggtttggtttaaggaggcaactagagagagccatgattgtaagaaggtgagaatgaatg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28466281 |
attgaagaagagaatggtttggtttaaggaggcaactagagagagccatgattgtaagaaggtgagaatgaatg |
28466208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 188 - 324
Target Start/End: Complemental strand, 28474787 - 28474651
Alignment:
| Q |
188 |
atgatattaatatttcatgagcatgtgatgatgaaaccaacctggtttctgaaaccatggtttggatttggagctttgaattggtggcattgaagaagag |
287 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| |||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
28474787 |
atgatattaatatttcatgtgcatgggatgaataaaccaacctggtttctgtaaccatggtttggatttggagctatgaatttgtggcattgaagaagag |
28474688 |
T |
 |
| Q |
288 |
aatggtttggtttaaggaggcaactagagagagccat |
324 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28474687 |
agtggtttggtttaaggaggcaactagagagagccat |
28474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 9 - 83
Target Start/End: Complemental strand, 28466557 - 28466483
Alignment:
| Q |
9 |
agcagagaaattgatcttccattcatctttttctttccttataatagtcctttccccatcactgcttgatgaagc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28466557 |
agcagagaaattgatcttccattcatctttttctttccttataatagtcctttccccatcactgcttgatgaagc |
28466483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 9 - 83
Target Start/End: Complemental strand, 28474978 - 28474904
Alignment:
| Q |
9 |
agcagagaaattgatcttccattcatctttttctttccttataatagtcctttccccatcactgcttgatgaagc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||| |||||||||| |
|
|
| T |
28474978 |
agcagagaaattgatcttccattcatctttttctttccttataacagtcctctcctcatcactgtttgatgaagc |
28474904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University