View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3238_high_28 (Length: 297)
Name: NF3238_high_28
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3238_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 37095304 - 37095574
Alignment:
| Q |
16 |
gtttttactctattttgttatgaatcaagtttaatgaagcaaaacaaaatacaaatgtgattcaggttatagaactcttaggaaatgaaattgaatataa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37095304 |
gtttttactctattttgttatgaatcaagtttaatgaagcaaaacaaaacacaaatgtgattcaggttatagaactcttaggaaatgaaattgaatataa |
37095403 |
T |
 |
| Q |
116 |
ctgaatattttgagatacagattctagctaacactctactaatcatcttattccatatgaatggttattactccactccctgcagattccattttgtgtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37095404 |
ctgaatattttgagatacagattctagctaacactctactaatcatcttattccatatgaatggttattactccactccctgcagattccattttgtgtg |
37095503 |
T |
 |
| Q |
216 |
gtcgttggatggacgattgaatgtcctatggacttgaattttaagcctttcgagacaacttcacttttcat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37095504 |
gtcgttggatggacgattgaatgtcctatggacttgaattttaagcctttcgagacaacttcacttttcat |
37095574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University