View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3238_high_34 (Length: 264)
Name: NF3238_high_34
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3238_high_34 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 4 - 264
Target Start/End: Original strand, 49563475 - 49563729
Alignment:
| Q |
4 |
acattttggggagttgagaagagctctgagacggtggcagtgaatcatttggaggcggtggcagtgttccctcagcgtctgaggaggcgctactgatatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
49563475 |
acattttggggagttgagaagagctctgagacggtggcagtgaatcatttggaggcggtggcagtgttacctcagcgtctgagg---cgctactgatatt |
49563571 |
T |
 |
| Q |
104 |
atgggacctaagggtgttcctcggtcagattgggtttggttctggtcaaactcattgctactactcaaaatatttgtaacccccgaatggcttggtgtat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49563572 |
atgggacctaagggtgttcctcggtcagattgggtttggttttggtcaaactcattgctactcctcaaaatatttgtaaccccctaatggcttggtgt-- |
49563669 |
T |
 |
| Q |
204 |
cgtaactccttattactcatgtttgagagttacgccctgatcggcctggatgtatcgtaac |
264 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49563670 |
-gtaactccttattactcatgttcgagagttacgccctgatcggcctggatgtatcgtaac |
49563729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University