View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3238_low_15 (Length: 428)
Name: NF3238_low_15
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3238_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 1 - 375
Target Start/End: Complemental strand, 30715305 - 30714931
Alignment:
| Q |
1 |
ttgttttggaattctattatgatgtttgggcttttgggcagtggcaggataatatgaagcagattcagataaagattgacggtgtgtccaagtcatgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30715305 |
ttgttttggaattctattatgatgtttgggcttttgggcagtggcaggataatatgaagcagattcagatgaagattgacggtgtgtccaagtcatgttt |
30715206 |
T |
 |
| Q |
101 |
gatttgctttaatttgttctcaacaactttgtatgttataatcttaagataatctcttctcttctaagggtgcagttgttggttagtttgaaaaattaac |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715205 |
gatttgctttaatttgttctcaacagctttgtatgttgtaatcttaagataatctcttctcttctaagggtgcagttgttggttagtttgaaaaattaac |
30715106 |
T |
 |
| Q |
201 |
tgtcgtctgctgttgggttttgagggatctattgggctccatttgaactattgggctttattatgaagttcaaaatactaggattaatgttgatgaaagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715105 |
gatcgtctgctgttgggttttgagggatctattgggctccatttgaactattgggctttattatgaagttcaaaatactaggattaatgttgatgaaagt |
30715006 |
T |
 |
| Q |
301 |
tgctctttagacttccaaaattgctctcaggtattgcaaaatgactcacatgtagttttatccttaaattgctct |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715005 |
tgctctttagacttccaaaattgctctcaggtattgcaaaatgactcacatgtagttttatccttaaattgctct |
30714931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University