View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3238_low_24 (Length: 365)
Name: NF3238_low_24
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3238_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 160 - 349
Target Start/End: Complemental strand, 3041085 - 3040896
Alignment:
| Q |
160 |
ggatatgcatgcaaaatatttagggcacaagatatattatcaagcaaaatatatataacatcaaattgtannnnnnnnnnnngttgttgaagagatatat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3041085 |
ggatatgcatgcaaaatatttagggcacaagatatattattaagcaaaatatatataacatcaaattgtattttttctttttgttgttgaagagatatat |
3040986 |
T |
|
| Q |
260 |
cggcaaatgttagtgaatttagtggtcccaaaacctctttcttaaaactccttcaaattgtatactatatatgtagtgtgcggttcttag |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3040985 |
aggcaaatgttagtgaatttagtggtcccaaaacctctttcttaaaactccttcaaattgtatactatatatgtagtgtgcggttcttag |
3040896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 3041245 - 3041144
Alignment:
| Q |
1 |
tccttacttgcgtaagattgatcttggtttgcataagggatacttggagttagctttggctttggagaagctctttggttgttgtggaattggtgagtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3041245 |
tccttacttgcgtaagattgatcttggtttgcataagggatacttggagttagctttggctttggagaagctctttggttgttgtggaattggtgagtta |
3041146 |
T |
|
| Q |
101 |
ca |
102 |
Q |
| |
|
|| |
|
|
| T |
3041145 |
ca |
3041144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University