View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3238_low_34 (Length: 279)
Name: NF3238_low_34
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3238_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 251
Target Start/End: Original strand, 33246815 - 33246903
Alignment:
| Q |
159 |
gaacattatcattcattacctggttggttcattcggcaatcaaatcctactatgtcattattttattgaaatagattgattgatattttatac |
251 |
Q |
| |
|
|||||||||||||||||||||| || ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246815 |
gaacattatcattcattacctgtttt----attgggcaatcaaatcttactatgtcattattttattgaaatagattgattgatattttatac |
33246903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University