View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3238_low_34 (Length: 279)

Name: NF3238_low_34
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3238_low_34
NF3238_low_34
[»] chr3 (1 HSPs)
chr3 (159-251)||(33246815-33246903)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 251
Target Start/End: Original strand, 33246815 - 33246903
Alignment:
159 gaacattatcattcattacctggttggttcattcggcaatcaaatcctactatgtcattattttattgaaatagattgattgatattttatac 251  Q
    |||||||||||||||||||||| ||     ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
33246815 gaacattatcattcattacctgtttt----attgggcaatcaaatcttactatgtcattattttattgaaatagattgattgatattttatac 33246903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University