View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3238_low_44 (Length: 235)
Name: NF3238_low_44
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3238_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 55 - 221
Target Start/End: Original strand, 49568104 - 49568270
Alignment:
| Q |
55 |
gtggaatttatcacatgttatctaatgacgaacatgttcacgacacaaatgtatcaaatgttatgtggattaaatatgttcctatgaaggtttcattatt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49568104 |
gtggaatttatcacatgttatctaatgacgagcatgttgacgacacaaatgtatcaaatgttgtgtggattaaatatgttcctatgaaggtttcattatt |
49568203 |
T |
|
| Q |
155 |
tagttgtttattactaaattatatgattcttacaaaggacaattttacttgttattcatgtggatta |
221 |
Q |
| |
|
||||||||| ||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49568204 |
tagttgtttgttactgaatgatatgattcctacaaaggacaattttacttgttattcatgtggatta |
49568270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 49567952 - 49568007
Alignment:
| Q |
1 |
ctgttggtagctgatatcaatagttaactattagctagcatgttgatacgaagggtggaa |
60 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
49567952 |
ctgttggtagctgatatgaatagttaactat----tagcatgttgatatgaagggtggaa |
49568007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University