View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3238_low_49 (Length: 218)
Name: NF3238_low_49
Description: NF3238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3238_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 1573634 - 1573824
Alignment:
| Q |
1 |
agaactttcagctacgagctctataataagcagtgggtcagcaatagtggcattatccatgccaaaattgcctaaacaatacagttttatattatttatn |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573634 |
agaactttcagttacgagctctataataagcagtgggtcagcaatagtggcattatccatgccaaaattgcctaaacaatacagttttatattatttat- |
1573732 |
T |
|
| Q |
101 |
nnnnnnnntacaggaaatcaagacaactagtcttgttcccttttatttatatttgcaagtctgatagattaaaaataaaagtaattagagct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573733 |
aaaaaaaatacaggaaatcaagacaactagtcttgttcccttttatttatatttgcaagtctgatagattaaaaataaaagtaattagagct |
1573824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 1579649 - 1579699
Alignment:
| Q |
16 |
gagctctataataagcagtgggtcagcaatagtggcattatccatgccaaa |
66 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
1579649 |
gagctctatgataagcagtgggtcagctatagtggcattatcaatgccaaa |
1579699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University