View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3241_high_11 (Length: 243)
Name: NF3241_high_11
Description: NF3241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3241_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 70 - 216
Target Start/End: Original strand, 11582293 - 11582450
Alignment:
| Q |
70 |
aatcacccactttacactaatgcaacattccatcaaaagagagcttcaaattgttaagagt-----------cattttgataaggggaaagtctttgctc |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11582293 |
aatcacccactttacactaatgcaacattccatcaaaagagagcttcaaattgttaagagtgattgtggtgacattttgataaggggaaagtctttgctc |
11582392 |
T |
 |
| Q |
159 |
tccattgagcttgctgagatttccaacaaatcaccaagtacatgtgtgattatttaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11582393 |
tccattgagcttgctgagatttccaacaaatcaccaagtacatgtgtgattatttaga |
11582450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 3 - 67
Target Start/End: Original strand, 21871353 - 21871417
Alignment:
| Q |
3 |
caaatgcagccctcccaagcaatattaagaagattaagcaactgtaaattcccaacaaatttcca |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
21871353 |
caaatgcagccctcccaagcaatattaagaagattaagcaactgtaaattcccagcaagtttcca |
21871417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University