View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3241_high_13 (Length: 231)
Name: NF3241_high_13
Description: NF3241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3241_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 15365221 - 15364998
Alignment:
| Q |
1 |
caacagaactctctaaccattgcatcagcgaaacccagtctccagtaatcattgcataatgcgcgatctagtcgctcaaaaatacgatatcttccattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15365221 |
caacagaactctctaaccattgcatcagcgaaacccagtctccagtaatcattgcatagtgcgcgatctagtcgctcaaaaatacgatatcttccattaa |
15365122 |
T |
 |
| Q |
101 |
aaagaggtcctaaccatgtaaaatcagcactaactgctcccaacacaacccatatgtcgcaagtgttgatattgtcaataaaaatatcacacttagttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15365121 |
aaagaggtcctaaccatgtaaaatcagcactaactgctcccaacacaacccatatgtcgcaagtgttgatattgtcaataaaaatatcacacttagttga |
15365022 |
T |
 |
| Q |
201 |
gacactaacctggcatttcttctc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
15365021 |
gacactaacctggcatttcttctc |
15364998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 81
Target Start/End: Complemental strand, 15365251 - 15365222
Alignment:
| Q |
52 |
ttgcataatgcgcgatctagtcgctcaaaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15365251 |
ttgcataatgcgcgatctagtcgctcaaaa |
15365222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University