View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3241_high_13 (Length: 231)

Name: NF3241_high_13
Description: NF3241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3241_high_13
NF3241_high_13
[»] chr5 (2 HSPs)
chr5 (1-224)||(15364998-15365221)
chr5 (52-81)||(15365222-15365251)


Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 15365221 - 15364998
Alignment:
1 caacagaactctctaaccattgcatcagcgaaacccagtctccagtaatcattgcataatgcgcgatctagtcgctcaaaaatacgatatcttccattaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
15365221 caacagaactctctaaccattgcatcagcgaaacccagtctccagtaatcattgcatagtgcgcgatctagtcgctcaaaaatacgatatcttccattaa 15365122  T
101 aaagaggtcctaaccatgtaaaatcagcactaactgctcccaacacaacccatatgtcgcaagtgttgatattgtcaataaaaatatcacacttagttga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15365121 aaagaggtcctaaccatgtaaaatcagcactaactgctcccaacacaacccatatgtcgcaagtgttgatattgtcaataaaaatatcacacttagttga 15365022  T
201 gacactaacctggcatttcttctc 224  Q
    ||||||||||||||||||||||||    
15365021 gacactaacctggcatttcttctc 15364998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 81
Target Start/End: Complemental strand, 15365251 - 15365222
Alignment:
52 ttgcataatgcgcgatctagtcgctcaaaa 81  Q
    ||||||||||||||||||||||||||||||    
15365251 ttgcataatgcgcgatctagtcgctcaaaa 15365222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University