View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3241_low_10 (Length: 245)
Name: NF3241_low_10
Description: NF3241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3241_low_10 |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 26885203 - 26885323
Alignment:
| Q |
18 |
aaatataggtgtgacataaaacacaactaatttattttccatatttttgttaaattaactcctatcaaatagctatctcatttcaataaaaataacaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26885203 |
aaatataggtgtgacataaaacacaactaatttatttttcatatttttgttaaattaactcccatcaaatagctatctcatttcaataaaaaaaacaaag |
26885302 |
T |
 |
| Q |
118 |
tcactatttcagtcatggaga |
138 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
26885303 |
tcactatttcagtcgtggaga |
26885323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 148 - 233
Target Start/End: Original strand, 22580480 - 22580565
Alignment:
| Q |
148 |
gcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacct |
233 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22580480 |
gcacatagtcctcaggggatgcacttgccaaccctcaaattttaattttttcacatatacccctatgttttttgcactttgaacct |
22580565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 138 - 230
Target Start/End: Original strand, 34059159 - 34059251
Alignment:
| Q |
138 |
agtggcagaggcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaa |
230 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34059159 |
agtggcaggtgcacatagtcttcaggggatgcacttgccaaccctcaaattttaattttttcacatatacccctatgttttttgcactttgaa |
34059251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 138 - 236
Target Start/End: Complemental strand, 33054341 - 33054239
Alignment:
| Q |
138 |
agtggcagaggcacatagtgctgaggggatgcacttgccaacc----ctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacct |
233 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
33054341 |
agtggcggaggcacatagtactgaggggatgcacttgccaaccaaccctcaaaattaaaaaatttcacatatacccttatgttttttgcactttaaacct |
33054242 |
T |
 |
| Q |
234 |
cct |
236 |
Q |
| |
|
||| |
|
|
| T |
33054241 |
cct |
33054239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 138 - 236
Target Start/End: Complemental strand, 48666141 - 48666043
Alignment:
| Q |
138 |
agtggcagaggcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacctcct |
236 |
Q |
| |
|
|||||||||| ||||| | | |||||||||||| ||||||||||||||| | | |||||||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
48666141 |
agtggcagagccacattgcggtgaggggatgcatttgccaaccctcaaattaattttttttcacatatatccctattgtttttgcattttgaacctcct |
48666043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 237
Target Start/End: Original strand, 18391436 - 18391525
Alignment:
| Q |
149 |
cacatagtgctgaggggatgcacttgccaaccctcaaaattaaatttttt-cacatatacccctatgttttttgcactttgaacctcctt |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||| |||||| |||||||| | ||| |||| ||| ||||||||||||| |
|
|
| T |
18391436 |
cacatagttgtgaggggatgcacttgccaaccctcaaatttaatttttttccacatatattcatattgttttagcaatttgaacctcctt |
18391525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 12372288 - 12372252
Alignment:
| Q |
149 |
cacatagtgctgaggggatgcacttgccaaccctcaa |
185 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
12372288 |
cacattgtggtgaggggatgcacttgccaaccctcaa |
12372252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 138 - 236
Target Start/End: Complemental strand, 41502035 - 41501937
Alignment:
| Q |
138 |
agtggcagaggcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacctcct |
236 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
41502035 |
agtggcggaggcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatatccctatgtttttagcactttgaacctcct |
41501937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 161 - 233
Target Start/End: Original strand, 19140259 - 19140331
Alignment:
| Q |
161 |
aggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacct |
233 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19140259 |
aggggatgcacttgccaaccctcaaattttaattttttcacatatacccctatgttttttgcaatttgaacct |
19140331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 138 - 236
Target Start/End: Original strand, 29635499 - 29635597
Alignment:
| Q |
138 |
agtggcagaggcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacctcct |
236 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29635499 |
agtggcggaggtacatagtgatgaggggatgcacttgccaaccttcaaaattaaattttttcatatatacccctatgttttttgcactttgaacctcct |
29635597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 138 - 234
Target Start/End: Complemental strand, 251496 - 251400
Alignment:
| Q |
138 |
agtggcagaggcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacctc |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
251496 |
agtggcagaggcacatagtgccgaggggatgcacttgccaaccctcaaaatttctttttttcacatatatccctatgttttttgcatgttgaacctc |
251400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 139 - 236
Target Start/End: Complemental strand, 39052770 - 39052673
Alignment:
| Q |
139 |
gtggcagaggcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacctcct |
236 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| || | |||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
39052770 |
gtggcggaggcacatagtgctgaggggatgcacttgccaaccctcaatttttatctttttcacatgtacccctgtgttttttgcactttgaacctcct |
39052673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 138 - 234
Target Start/End: Complemental strand, 3695286 - 3695190
Alignment:
| Q |
138 |
agtggcagaggcacatagtgctgaggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacctc |
234 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||| || | ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3695286 |
agtggcagaggcacatagtgctgagaagatgcacttgccaactctcaatttttatctttttcacaaatacccctatgttttttgcactttgaacctc |
3695190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 161 - 233
Target Start/End: Complemental strand, 678875 - 678803
Alignment:
| Q |
161 |
aggggatgcacttgccaaccctcaaaattaaattttttcacatatacccctatgttttttgcactttgaacct |
233 |
Q |
| |
|
||||||| || ||||||||||||||| || |||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
678875 |
aggggatacatttgccaaccctcaaattttaattttttcacatatatccttatgttttttgcactttgaacct |
678803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 193 - 236
Target Start/End: Original strand, 45241 - 45284
Alignment:
| Q |
193 |
ttttttcacatatacccctatgttttttgcactttgaacctcct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45241 |
ttttttcacatatacccctatgttttttgcactttgaacctcct |
45284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University