View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3241_low_15 (Length: 208)
Name: NF3241_low_15
Description: NF3241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3241_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 31583118 - 31582944
Alignment:
| Q |
17 |
agaggactatttgcaaggactatgtccaacaaaacttgtcaacacaacattagaccctgacctctttgtttatggtcctgactacaataatcttacactc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31583118 |
agaggactatttgcaaggactatgtccaacaaaacttgtcaacacaacattagaccccgacctctttgtttatggtcctgactacaataatcttacactc |
31583019 |
T |
 |
| Q |
117 |
ttctatggttgtccaccttcaattaatttccctttgaacgggcgctttctatgtccttcaaatggatattctgat |
191 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31583018 |
ttctatggttgtccaccttcaattactttccctttgaacgggcgctttctatgtccttcaaatggatattctgat |
31582944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 31641724 - 31641550
Alignment:
| Q |
17 |
agaggactatttgcaaggactatgtccaacaaaacttgtcaacacaacattagaccctgacctctttgtttatggtcctgactacaataatcttacactc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641724 |
agaggactatttgcaaggactatgtccaacaaaacttgtcaacacaacattagaccccgacctctttgtttatggtcctgactacaataatcttacactc |
31641625 |
T |
 |
| Q |
117 |
ttctatggttgtccaccttcaattaatttccctttgaacgggcgctttctatgtccttcaaatggatattctgat |
191 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641624 |
ttctatggttgtccaccttcaattactttccctttgaacgggcgctttctatgtccttcaaatggatattctgat |
31641550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University