View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3241_low_6 (Length: 268)
Name: NF3241_low_6
Description: NF3241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3241_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 252
Target Start/End: Original strand, 28030641 - 28030891
Alignment:
| Q |
6 |
gagagaagaacagttactca----ggttatatctgaacgtttatgataatccaatttgttaaggatttcagcaaaagtaggattccttatttttctaatt |
101 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28030641 |
gagagaagaacagttactcacttaggttatatctgaacgtttaagataatccaatttgttaaggatttcagcaaaagtaggattccttaattttctaatt |
28030740 |
T |
 |
| Q |
102 |
atccgtttagcatagagacctattcatccgtatatattgctctcttagccttatggataactactactatggcactatcttctttgtgactggaccacga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030741 |
atccgtttagcatagagacctattcatccgtatatattgctctcttagctttatggataactactactatggcactatcttctttgtgactggaccacga |
28030840 |
T |
 |
| Q |
202 |
tgacactgtaacaaatttatctattttcatgtgactaaatatagatacata |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030841 |
tgacactgtaacaaatttatctattttcatgtgactaaatatagatacata |
28030891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University