View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3242_low_3 (Length: 234)
Name: NF3242_low_3
Description: NF3242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3242_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 6371389 - 6371178
Alignment:
| Q |
14 |
agttttctcctaaatcacacgcttttagaccggggagaaatgcgcatacggttataagaacaattagaagtaattttgcgggttatttgtggtttttgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6371389 |
agttttctcctaaatcacacgcttttagaccggggagaaatgcgcatacggttataagaacaattagaagtaatttcgcgggttatttgtggtttttgaa |
6371290 |
T |
 |
| Q |
114 |
gggtgatttgagtgagatttttgagaaagttgatactgatgttgtgatggaatgtgttgaaaagggtactagagataagaaagttttgagtttgataaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371289 |
gggtgatttgagtgagatttttgagaaagttgatactgatgttgtgatggaatgtgttgaaaagggtactagagataagaaagttttgagtttgataaaa |
6371190 |
T |
 |
| Q |
214 |
tcggtgatgatg |
225 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
6371189 |
tcggcgatgatg |
6371178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University