View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3243_high_2 (Length: 363)
Name: NF3243_high_2
Description: NF3243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3243_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 19 - 350
Target Start/End: Complemental strand, 41667473 - 41667147
Alignment:
| Q |
19 |
aataagcgatgaagattgaagttggaacctttctctgagcttttttagccatatactgtgaaatttcctcttctgtgattgttctggaagatttcttctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667473 |
aataagcgatgaagattgaagttggaacctttctctgagcttttttagccatatactgtgaaatttcctcttctgtgattgttctggaagatttcttctt |
41667374 |
T |
 |
| Q |
119 |
tcttccagttctattaacgttgtcgtcacttgaatcatcatctgaatctcggcgtgaccggcgactagttttccggcggtggtcggagtcggagtcggag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41667373 |
tcttccagttctattaacgttgtcgtcacttgaatcatcatctgaatctcggcgtgaccggcgactagttttccggcggtggtcggagtcgg------ag |
41667280 |
T |
 |
| Q |
219 |
tcagatgcagagtcatcatcggatcttcttcgtcttcgagattttctactactactaccgctcgccattgtttaaccctaaaccttggcgatgttattga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667279 |
tcagatgcagagtcatcatcggatcttcttcgtcttcgagattttctactactactaccgctcgccattgtttaaccctaaaccttggcgatgttattga |
41667180 |
T |
 |
| Q |
319 |
tatg-aaatcaatcgaatttcaccacacaggtt |
350 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |
|
|
| T |
41667179 |
tatgaaaatcaatcgaatttcatcacacaggtt |
41667147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University