View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3243_high_3 (Length: 352)
Name: NF3243_high_3
Description: NF3243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3243_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 27693629 - 27693449
Alignment:
| Q |
18 |
tgaacagcatcagcaagacagagaccgtgaccgggaagaggaacaattgtcataccgcagcatgatatacgatacagcagtgcgcgctctatttctcttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
27693629 |
tgaacagcatcagcaagacagagaccgtgaccgggaagaggaacaattgtcataccccagcatgatatacgatacagcaatgggcgctctatttttcttc |
27693530 |
T |
 |
| Q |
118 |
attctcttgcgtaagt-nnnnnnnnnncgcactagatacacatttagttaaaagaca-----cttctatcatatgcattgg |
192 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27693529 |
attctcttgcgtaagtaaaaaaaaaaacgcactagatacacatttagttaaaagacacttagcttctatcatatgcattgg |
27693449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 258 - 342
Target Start/End: Complemental strand, 27693383 - 27693299
Alignment:
| Q |
258 |
gaaatatatatgcattactctgtctcctgaaacaccattgaattacaacttacaagaaattcattaggatattcaacattctctg |
342 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693383 |
gaaatatacatgcattactttgtctcctgaaacaccattgaattacaacttacaagaaattcattaggatattcaacattctctg |
27693299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University