View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3244_low_3 (Length: 344)
Name: NF3244_low_3
Description: NF3244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3244_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 7 - 327
Target Start/End: Complemental strand, 44646198 - 44645875
Alignment:
| Q |
7 |
cgtgtttcagcaaagaaaggacaccatcatggaatgcatcacaacaagcatgcaaaggagtttgaaaaagtattggaagagaagaaagggat---atcaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
44646198 |
cgtgtttcagcaaagaaaggacaccatcatggaatgcatcacaaccagcatgcaaaggagtttgaaaaagtactggaagagaagaaagggatcatatcaa |
44646099 |
T |
|
| Q |
104 |
agaatgaacaagtcagttcgaaagacgaacacggtgaaacttggaggaggagcaaccaccggaacaaagaagaaatggaggatcaaaatttctcctaaga |
203 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44646098 |
agaataaacaagtcaggtcgaaagacgaacacggtgaaacttggaggaggagcaaccaccggaacaaagaagaaatggaggatcaaaatttctcctaaga |
44645999 |
T |
|
| Q |
204 |
taaaatttccaacaatttcttctcctaagaaatggatggtgtggatgagagactcctatgtgaggatgatgcttggtttggctaactcaaaggtaatgaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44645998 |
taaaatttccaacaatttcttctcctaagaaatggatggtgtggatgagagactcctatgtgaggatgatgcttggtttggctaactcgaaggtaatgaa |
44645899 |
T |
|
| Q |
304 |
tttgactagcttcaatgaccccac |
327 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44645898 |
tttgactagcttcaatgaccccac |
44645875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University