View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3244_low_8 (Length: 257)
Name: NF3244_low_8
Description: NF3244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3244_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 35800274 - 35800040
Alignment:
| Q |
12 |
aaatatatcatgatattgtgaatagttgctgtcacatgcaggttgatgcagcacaattgtgttgtggagacatcaaaaccaaaccttgattgtgaccact |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800274 |
aaatatatcatgatattgtgaatagttgctgtcacatgcaggttgatgcagcacaattgtgttgtggagacatcaaaaccaaaccttgattgtgaccact |
35800175 |
T |
|
| Q |
112 |
ttacttttgaattggttcaattggggnnnnnnnggttttaacaattggggtttttcaattaaagttgatagataactatgtttctgtttgtgttggatat |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800174 |
ttacttttgaattggttcaattgggg-ttttttggttttaacaattggggtttttcaattaaagttgatagataactatgtttctgtttgtgttggatat |
35800076 |
T |
|
| Q |
212 |
tctgctgattatgttctgtaataatttttgtctgtg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800075 |
tctgctgattatgttctgtaataatttttgtctgtg |
35800040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 175 - 249
Target Start/End: Complemental strand, 35786858 - 35786784
Alignment:
| Q |
175 |
gttgatagataactatgtttctgtttgtgttggatattctgctgattatgttctgtaataatttttgtctgtgct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
35786858 |
gttgatagataactatgtttctgtttgtgttggatcttctgccaattatgttctgtaatcacttttgtctgtgct |
35786784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 176 - 249
Target Start/End: Complemental strand, 35761929 - 35761856
Alignment:
| Q |
176 |
ttgatagataactatgtttctgtttgtgttggatattctgctgattatgttctgtaataatttttgtctgtgct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||| |||||||||||||| | | |||||| |||||| |
|
|
| T |
35761929 |
ttgatagataactatgtttctgtttgtgttggatcttatgcagattatgttctgtattcacttttgtttgtgct |
35761856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University