View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3246_low_4 (Length: 244)
Name: NF3246_low_4
Description: NF3246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3246_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 60 - 228
Target Start/End: Complemental strand, 25797564 - 25797396
Alignment:
| Q |
60 |
caagtaaaacgaggtcttgaatgtgttctagttccaagactctttatattgtaattgtaaaaagtgaagagaatatatttagttgttgttggcttttgct |
159 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25797564 |
caagtaaaatgaggtcttgaatgtgttctagttccaagactctttatattgtaattgtaaaaagtgaagagaatatatttagttgttgttggcttttgct |
25797465 |
T |
 |
| Q |
160 |
tcttgtaccctgtattgtgtatgctatcgcatacacaaggctaatactctcaataagagaacaataaat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25797464 |
tcttgtaccctgtattgtgtatgctatcgcatacacaaggctaatactctcaataatagaacaataaat |
25797396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University