View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3246_low_7 (Length: 227)
Name: NF3246_low_7
Description: NF3246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3246_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 16510015 - 16509811
Alignment:
| Q |
15 |
caatctcaatcttccttcccaacaatgaccacccaggctcaacaggaaactcaccatcctcgagattcggaatcagaatcttcttctcctcaactacctc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
16510015 |
caatctcaatcttccttcccaacaatgaccacccaggctcaacaggaaactcaccatcctcaagattcggaatctggatcttcttctcttcaactacctc |
16509916 |
T |
 |
| Q |
115 |
cttcttcaccaccttcaaaaccctaacttcatcactcacagctgctttccctttcaccaccttcaacacttccacttcatcatcacaaacggttttcttc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16509915 |
cttcttcaccaccttcaaaaccctaacttcatcactcacagcttctttccccttcaccaccttcaacacttccacttcatcatcacaaacggttttcttc |
16509816 |
T |
 |
| Q |
215 |
tctgc |
219 |
Q |
| |
|
||||| |
|
|
| T |
16509815 |
tctgc |
16509811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University