View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3247_high_8 (Length: 209)

Name: NF3247_high_8
Description: NF3247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3247_high_8
NF3247_high_8
[»] chr1 (1 HSPs)
chr1 (14-189)||(42133694-42133869)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 42133869 - 42133694
Alignment:
14 aagaatatcataggggagttgaactatagctaacnnnnnnnngaagctacaacaagtaccacctattgaggaaaaaagaagagatcttggatccaaacga 113  Q
    ||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42133869 aagaatatcataggggagttgaactatagctaacaaaaaaaagaagctacaacaagtaccacctattgaggaaaaaagaagagatcttggatccaaacga 42133770  T
114 aaaggactaggattctaggaaatttaggaggaagggaaggaccactcttaattaattgaagtggatgggaaggata 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42133769 aaaggactaggattctaggaaatttaggaggaagggaaggaccactcttaattaattgaagtggatgggaaggata 42133694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University