View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3247_low_9 (Length: 231)

Name: NF3247_low_9
Description: NF3247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3247_low_9
NF3247_low_9
[»] chr8 (1 HSPs)
chr8 (1-105)||(37936833-37936937)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 37936833 - 37936937
Alignment:
1 aaggtagaaagcatattgatacccacgatgcttcatattaagaaaaatattaaattgattaaaaatgattaactacctactaacaaccactaactgactt 100  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37936833 aaggcagaaagcatatcgatacccacgatgcttcatattaagaaaaatattaaattgattaaaaatgattaactacctactaacaaccactaactgactt 37936932  T
101 gtaag 105  Q
    |||||    
37936933 gtaag 37936937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University