View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3248_high_15 (Length: 350)
Name: NF3248_high_15
Description: NF3248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3248_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 134 - 282
Target Start/End: Complemental strand, 21254812 - 21254664
Alignment:
| Q |
134 |
gaattctgaaatcgaaggaaccttgaaattaaacaacgaagaagattccaatcaagaaaacaaacaaggagtgaagggaatccaaaccgaaatgaaatga |
233 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
21254812 |
gaattctgaaattgaaggaaccttgaaattgaacaaggaagaagattccaatcaagaaaacaaacaagaagtgaaaggaatccaaacataaatgaaatga |
21254713 |
T |
|
| Q |
234 |
atttgctctgatgaaaggagaaacggaaatcctagaaattggggaaaat |
282 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
21254712 |
attttctctgatgaaagacgaaacggaaaccctagaaattgggaaaaat |
21254664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University