View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3248_high_16 (Length: 349)
Name: NF3248_high_16
Description: NF3248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3248_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 18 - 113
Target Start/End: Complemental strand, 413113 - 413018
Alignment:
| Q |
18 |
aattcatgctccgtacttccgtcatcgatttatgttatacaatttagtactcctaagctaaatcactgcctaattaacttggaggcatatctattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
413113 |
aattcatgctccgtacttccgtcatcgatttatgttatacaatttagtcctcttaagctaaatcactgcctaattaacttggaggcatatctattt |
413018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 235 - 335
Target Start/End: Complemental strand, 412121 - 412018
Alignment:
| Q |
235 |
taaagtgaaaactcattttagtccttaacaccgactagaagactcaatttggtcaacgaaatagaactttaagtccatgacaa---aaaaggggacaact |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
412121 |
taaagtgaaaactcattttagtccttaacaacgactagaagactcaatttggtcaacgaaatataactttaagtccatgacaaaaaaaaaggggacaact |
412022 |
T |
 |
| Q |
332 |
tatc |
335 |
Q |
| |
|
|||| |
|
|
| T |
412021 |
tatc |
412018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 168
Target Start/End: Complemental strand, 412501 - 412473
Alignment:
| Q |
140 |
tatctaattatgatatcttacgagcaagc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
412501 |
tatctaattatgatatcttacgagcaagc |
412473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University