View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3248_high_36 (Length: 227)
Name: NF3248_high_36
Description: NF3248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3248_high_36 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 26653480 - 26653254
Alignment:
| Q |
1 |
atcaagtcgacttatgcaacatatcaaaatcccttgattgatcttttgatttggggcatgctagaatcatacatcccttgtaaggaaaacaggcaagggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
26653480 |
atcaagtcgacttatgcaacatatcaaaatcccttgattgatcttttgacttggggcatgctagaatcagacatcccttataaggaaaacaggcaagggt |
26653381 |
T |
 |
| Q |
101 |
acttgtcgggctacgtttacaatcacacatattgttggaacttaatgtttctcttttaggtaattaatcgtaacatcagaggttagagattagagacgat |
200 |
Q |
| |
|
| ||||||| || |||||||||||| || ||||||| ||||||||| |||| ||||| |||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26653380 |
atttgtcggattaggtttacaatcacgcacattgttgaaacttaatgcttcttttttaagtaactaatcgtaacatcagaggttagagactagagacgat |
26653281 |
T |
 |
| Q |
201 |
ctaccattatttacgagacatcaagat |
227 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
26653280 |
ctaccattatttacgagatatcaagat |
26653254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University