View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3248_high_36 (Length: 227)

Name: NF3248_high_36
Description: NF3248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3248_high_36
NF3248_high_36
[»] chr1 (1 HSPs)
chr1 (1-227)||(26653254-26653480)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 26653480 - 26653254
Alignment:
1 atcaagtcgacttatgcaacatatcaaaatcccttgattgatcttttgatttggggcatgctagaatcatacatcccttgtaaggaaaacaggcaagggc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||     
26653480 atcaagtcgacttatgcaacatatcaaaatcccttgattgatcttttgacttggggcatgctagaatcagacatcccttataaggaaaacaggcaagggt 26653381  T
101 acttgtcgggctacgtttacaatcacacatattgttggaacttaatgtttctcttttaggtaattaatcgtaacatcagaggttagagattagagacgat 200  Q
    | |||||||  || |||||||||||| || ||||||| ||||||||| |||| ||||| |||| ||||||||||||||||||||||||| ||||||||||    
26653380 atttgtcggattaggtttacaatcacgcacattgttgaaacttaatgcttcttttttaagtaactaatcgtaacatcagaggttagagactagagacgat 26653281  T
201 ctaccattatttacgagacatcaagat 227  Q
    |||||||||||||||||| ||||||||    
26653280 ctaccattatttacgagatatcaagat 26653254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University