View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3248_low_40 (Length: 226)
Name: NF3248_low_40
Description: NF3248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3248_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 21261605 - 21261672
Alignment:
| Q |
19 |
tatcttccactttatagcaccagaatgacaataataattaactaccaaaacaattgtcatcaaactat |
86 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21261605 |
tatctttcactttatagcaccagaatgacaataataattaattaccaaaacaattgtcatcaaactat |
21261672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University