View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3248_low_41 (Length: 225)
Name: NF3248_low_41
Description: NF3248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3248_low_41 |
 | |
|
| [»] scaffold0710 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0710 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: scaffold0710
Description:
Target: scaffold0710; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 4545 - 4343
Alignment:
| Q |
1 |
aaatcttttcactttatcagcaaaactgtaaaatgatttccaatagcttgagcttttcttagtattgttggtttcatgatccattgaaacttttatgcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4545 |
aaatcttttcactttatcagcaaaactgtaaaatgatttccaatagcttgagcttttcttagtattgttggtttcatgatccattgaaacttttatgcct |
4446 |
T |
|
| Q |
101 |
aaatcaacttttgaatgagatagtcattaaaagtttcagttatgataaagggtctgttacttatatagcttaaatgctttggacaagagaagagaatatt |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4445 |
aaatcaaattttgaatgagatagtcattaaaagtttcagttatgataaagggtctgttacttatatagcttaaatgctttggacaagagaagagaatatt |
4346 |
T |
|
| Q |
201 |
gaa |
203 |
Q |
| |
|
||| |
|
|
| T |
4345 |
gaa |
4343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 51860586 - 51860384
Alignment:
| Q |
1 |
aaatcttttcactttatcagcaaaactgtaaaatgatttccaatagcttgagcttttcttagtattgttggtttcatgatccattgaaacttttatgcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51860586 |
aaatcttttcactttatcagcaaaactgtaaaatgatttccaatagcttgagcttttcttagtattgttggtttcatgatccattgaaacttttatgcct |
51860487 |
T |
|
| Q |
101 |
aaatcaacttttgaatgagatagtcattaaaagtttcagttatgataaagggtctgttacttatatagcttaaatgctttggacaagagaagagaatatt |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51860486 |
aaatcaaattttgaatgagatagtcattaaaagtttcagttatgataaagggtctgttacttatatagcttaaatgctttggacaagagaagagaatatt |
51860387 |
T |
|
| Q |
201 |
gaa |
203 |
Q |
| |
|
||| |
|
|
| T |
51860386 |
gaa |
51860384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 51850139 - 51850064
Alignment:
| Q |
1 |
aaatcttttcactttatcagcaaaactgtaaaatgatttccaatagcttgagcttttcttagtattgttggtttca |
76 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||| |||||||||| || |||||||||| |||||| |
|
|
| T |
51850139 |
aaatcttttcactttataaacaaaactgtaaaatgatttccaatggcttgagcttctcatagtattgttagtttca |
51850064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 49809183 - 49809236
Alignment:
| Q |
1 |
aaatcttttcactttatcagcaaaactgtaaaatgatttccaatagcttgagct |
54 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49809183 |
aaatcttttcactttataagcaaaactgtaaaatgatttccaatggcttgagct |
49809236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 51820589 - 51820490
Alignment:
| Q |
1 |
aaatcttttcactttatcagcaaaactgtaaaatgatttccaatagcttgagcttttcttagtattgttggtttcatgatccattgaaacttttatgcct |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| |||||||| | |||||||| |||||||||| | |||||||||||| |||||| |
|
|
| T |
51820589 |
aaatcttttcactttatcagctaaactgtaaatgaatttccaatggcttgagcatgtcttagtactgttggtttc---agtcattgaaactttcatgcct |
51820493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University