View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3249_high_21 (Length: 237)
Name: NF3249_high_21
Description: NF3249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3249_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28029428 - 28029652
Alignment:
| Q |
1 |
ttaatgactttacttttggagctatcctggaaagttcacaaattccatttccttgataagaagcgttttttcttgtcgatatgactacgaaaatttcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28029428 |
ttaatgactttacttttggagctatcctggaaagttcacaaattccatttccttgataagaagcgttttttcttgtcgatatgactacgaaaatttcctt |
28029527 |
T |
|
| Q |
101 |
gagaccaaatagttgcctcacacacagccac--ataatcta--ttatgaaattgccttataggtacaatcgtattattttctttggttaaccaaagttgt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28029528 |
gagaccaaatagttgcctcacacacagccacatatagtctattttatgaaattgccttataggtacaatcgtattattttctttggttaaccaaagttgt |
28029627 |
T |
|
| Q |
197 |
gagactccatcgtaatttttcttat |
221 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
28029628 |
gagactccatcataatttttcttat |
28029652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University