View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3249_high_6 (Length: 469)
Name: NF3249_high_6
Description: NF3249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3249_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 438; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 438; E-Value: 0
Query Start/End: Original strand, 18 - 459
Target Start/End: Complemental strand, 3308500 - 3308059
Alignment:
| Q |
18 |
gttgccgcccgtaacaacttcgcggctgcgcattcctcctacgccgcctcactcaagaacaccggcgcggctctcatagattttgcacaaggagaacaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308500 |
gttgccgcccgtaacaacttcgcggctgcgcattcctcctacgcagcctcactcaagaacaccggcgcggctctcatagattttgcacaaggagaacaac |
3308401 |
T |
 |
| Q |
118 |
aacaaaatcttttattctctccttcttatgatgttcctttgcctcctcctcctcttcctgatttgcctgctgctctccggcgtgctattaccatgccgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308400 |
aacaaaatcttttattctctccttcttatgatgttcctttgcctcctcctcctcttcctgatttgcctgctgctctccggcgtgctattaccatgccgga |
3308301 |
T |
 |
| Q |
218 |
gtttgaatcagacatggttgtggaagaggaagaggatggtgatggtgatgaagaagttgttggaagagtgaaagagagagtgaatatggatatgattcaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308300 |
gtttgaatcagacatggttgtggaagaggaagaggatggtgatggtgatgaagaagttgttggaagagtgaaagagagagtgaatatggatatgattcaa |
3308201 |
T |
 |
| Q |
318 |
gtgttgagtgaagttgataatcattttataatggcttctgaagctgctcgcggtgtttctgtgattcttcaggctactcgtcttcactttcattcaaatt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308200 |
gtgttgagtgaagttgataatcattttataatggcttctgaagctgctcgcggtgtttctgtgattcttcaggctactcgtcttcactttcattcaaatt |
3308101 |
T |
 |
| Q |
418 |
tttctgatactgctagaggtaaccacaaaaatccatgttcat |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308100 |
tttctgatactgctagaggtaaccacaaaaatccatgttcat |
3308059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University