View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3249_low_27 (Length: 220)
Name: NF3249_low_27
Description: NF3249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3249_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 121 - 204
Target Start/End: Original strand, 35381791 - 35381874
Alignment:
| Q |
121 |
aaagcaaaacaatacattaatataacaacattcttcaatggcatcatcaaagccagtttctgtactcttgttaaccattacaat |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35381791 |
aaagcaaaacaataccttaatataacaacattcttcaatggcatcatcaaagccagtttctgtaatcttgttaaccattacaat |
35381874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University