View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3249_low_28 (Length: 203)
Name: NF3249_low_28
Description: NF3249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3249_low_28 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 40 - 203
Target Start/End: Complemental strand, 38771035 - 38770872
Alignment:
| Q |
40 |
tgtggtggttcctccggctgaggagaaagtgattgaagtggttttaacaaaagcagaatctgtggataacaaagtagtggaagcaacatctagcatagaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38771035 |
tgtggtggttcctccggctgaggagaaagtgattgaagtggttttaacaaatgcagaatctgtggataacaaagtagtggaagcaacatctagcatagaa |
38770936 |
T |
 |
| Q |
140 |
gatatatccaaggcttctgatgttggttggcagcagtgataaagcttccatctcttaatccaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38770935 |
gatatatccaaggcttctgatgttggttggcagcagtgataaagcttccatctcttgatccaac |
38770872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University