View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3250_low_1 (Length: 465)
Name: NF3250_low_1
Description: NF3250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3250_low_1 |
 | |
|
| [»] scaffold0197 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 19 - 453
Target Start/End: Original strand, 39738138 - 39738576
Alignment:
| Q |
19 |
gaagttgtgttgatat-agagtttcagaatgctcaaaaacaaattctagagtttggaaaagtgagaaagtcttggtgatcacaactgtttgagcttaata |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39738138 |
gaagttgtgttgatattagagtttcagaatgctcaaaaacaaattctagagtttggaaaagtgagaaagtcttggtgatcacaactgtttgagcttaata |
39738237 |
T |
|
| Q |
118 |
tcctggtacacttgcatatttnnnnnnnnnggtaaactgataatcagaaggtaactatcagtgtagattgatacggtgattgtatggtggttgaagcctc |
217 |
Q |
| |
|
| | ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
39738238 |
ttcgggtacacttgcatattttaaaaaaa-ggtaaactgataatcagaaggtaactatcagtgtagtttgatacggtgattgtatgatggttgaagcctc |
39738336 |
T |
|
| Q |
218 |
agttgttgactggaacgacgaggtgtgtgtacctgtaaacacaccgtcgctcaagt----acttgagtcataatgggagtttagagaacaagaagattct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39738337 |
agttgttgactggaacgacgaggtgtgtgtacatgtaaacacatcgtcgcttaagtcattacttgagtcataatgggagtttagagaacaagaagattct |
39738436 |
T |
|
| Q |
314 |
aaccctgaggattgctgagagtcccctttatatagagaatgagtgttgcagggccattgtatgatacacgtagggctcagaggttacagattcgcgggag |
413 |
Q |
| |
|
|||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39738437 |
aaccttgaggattactgaaagtcccctttatatagagaatgagtgttgcagggccattgtatgacacacgtagggctcggaggttacagattcgcgggag |
39738536 |
T |
|
| Q |
414 |
ccatgttgagaaccgttattattcactttgaataggtctc |
453 |
Q |
| |
|
||||| | |||||||||||| ||||||||||| ||||||| |
|
|
| T |
39738537 |
ccatgataagaaccgttattgttcactttgaacaggtctc |
39738576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 307 - 349
Target Start/End: Complemental strand, 36734990 - 36734948
Alignment:
| Q |
307 |
agattctaaccctgaggattgctgagagtcccctttatataga |
349 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||| |
|
|
| T |
36734990 |
agattctaaccttgaggactactgagagtcccctttatataga |
36734948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 303 - 384
Target Start/End: Complemental strand, 1833872 - 1833791
Alignment:
| Q |
303 |
aagaagattctaaccctgaggattgctgagagtcccctttatatagagaatgagtgttgcagggccattgtatgatacacgt |
384 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||||||||||||| ||||||||||| |||| |||| ||| |||||| |
|
|
| T |
1833872 |
aagaagattctaaccttgtggaccgctgagagtcccctttatatagagagtgagtgttgcatggccgttgtctgacacacgt |
1833791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0197 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 307 - 351
Target Start/End: Complemental strand, 24324 - 24280
Alignment:
| Q |
307 |
agattctaaccctgaggattgctgagagtcccctttatatagaga |
351 |
Q |
| |
|
||||||||||| |||||| |||||| ||||||||||||||||||| |
|
|
| T |
24324 |
agattctaaccttgaggaatgctgaaagtcccctttatatagaga |
24280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 303 - 350
Target Start/End: Original strand, 15394400 - 15394447
Alignment:
| Q |
303 |
aagaagattctaaccctgaggattgctgagagtcccctttatatagag |
350 |
Q |
| |
|
||||||||||||||| || ||||||| | ||||||||||||||||||| |
|
|
| T |
15394400 |
aagaagattctaaccttggggattgcagggagtcccctttatatagag |
15394447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 351
Target Start/End: Complemental strand, 21310707 - 21310663
Alignment:
| Q |
307 |
agattctaaccctgaggattgctgagagtcccctttatatagaga |
351 |
Q |
| |
|
||||||||||| | |||| |||||| ||||||||||||||||||| |
|
|
| T |
21310707 |
agattctaaccttaaggaatgctgaaagtcccctttatatagaga |
21310663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University