View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3250_low_11 (Length: 239)
Name: NF3250_low_11
Description: NF3250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3250_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 36064710 - 36064490
Alignment:
| Q |
19 |
taaaaagcccttctaatgtatagttcaatatacaagaacaacaggagcaatctatttactcaacaagagaaacaacaccaactattcctccttgattttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064710 |
taaaaagcccttctaatgtatagttcaatatacaagaacaacaggagcaatctatttactcaacaagagaaacaacaccaactattcctccttgattttt |
36064611 |
T |
 |
| Q |
119 |
tgctcaaattaagcaaacaatgaaacagaaataccagcaagtttgttagcactcaaccttggcttcgatttcttcgacatcaaaggtgcatttggagctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064610 |
tgctcaaattaagcaaacaatgaaacagaaataccagcaagtttgttagcactcaaccttggcttcgatttcttcgacatcaaaggtgcatttggagctt |
36064511 |
T |
 |
| Q |
219 |
caatttcatcatcaaacccat |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36064510 |
caatttcatcatcaaacccat |
36064490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University