View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3250_low_6 (Length: 252)
Name: NF3250_low_6
Description: NF3250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3250_low_6 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 78 - 252
Target Start/End: Complemental strand, 25027357 - 25027185
Alignment:
| Q |
78 |
gccaacatattgagagttttgaacattttgggaattctgaattctcacttctcattcattttgaacaaaacaaagagtgaatcagcttgttgctacttca |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25027357 |
gccaacatattgagagttttgaacattttgggaattctgaattctcacttctcattcattttgaacaaaacaaag-gtgaatcagcttgttgctacttca |
25027259 |
T |
 |
| Q |
178 |
accatgtgatccctataggtgatgagtaattatatgacagttagacttatgcatatgacaaaactaataatgaat |
252 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
25027258 |
accatgtgatccctataggtgatgag-acctatatgacagttagacttatgcatgtgacaaaagtaataatgaat |
25027185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 11 - 86
Target Start/End: Complemental strand, 25031964 - 25031889
Alignment:
| Q |
11 |
cagagagggatgggactggaaccaatcagtacgtatttttggagggaagtgataatgtgataaccatgccaacata |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031964 |
cagagagggatgggactggaaccaatcagtacgtatttttggagggaagtgataatgtgataaccatgccaacata |
25031889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University