View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3250_low_9 (Length: 247)
Name: NF3250_low_9
Description: NF3250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3250_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 36064107 - 36063865
Alignment:
| Q |
1 |
tggtgaattaaacg---aaattgattgcaaaacttacaagtaggtcttgaggaagggcttcaaggcgagatttttcagaaatggtatcaaatcttccact |
97 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36064107 |
tggtgaattaaacggtgaaattgattgcaaaacttacaaggagatcttgaggaagggcttcaaggcgagatttttcagaaatggtatcgaatcttccact |
36064008 |
T |
 |
| Q |
98 |
gcacattctcttcaatggaaccgttacaggattggattcaaaagcttcatcgttgtttgaaacaacaaccctttttcttccaagagcacgaccataacta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064007 |
gcacattctcttcaatggaaccgttacaggattggattcaaaagcttcatcgttgtttgaaacaacaaccctttttcttccaagagcacgaccataacta |
36063908 |
T |
 |
| Q |
198 |
taagtatcaaaccctagcgtcatatctgaaaccgttcatctca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36063907 |
taagtatcaaaccctagcgtcatatctgaaaccgttcttctca |
36063865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University