View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3251_low_4 (Length: 227)
Name: NF3251_low_4
Description: NF3251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3251_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 7 - 95
Target Start/End: Original strand, 10532484 - 10532572
Alignment:
| Q |
7 |
aagaggtgtcggtgttagagaggattttactcaatacgtctaaaagtatatgttaatttagtacattacatatgaaataacaaacacag |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
10532484 |
aagaggtgtcggtgttagagaggattttactcaatacgtctaaaagtatatgttaatctggtacattacacatgaaataacaaacacag |
10532572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 174 - 227
Target Start/End: Original strand, 10532651 - 10532704
Alignment:
| Q |
174 |
ccagaaacaagtagaattagcaacattaaattatcatgtaaaaagtgtaacaaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10532651 |
ccagaaacaagtagaattagcaacattaaattatcatgtaaaaagtgtaacaaa |
10532704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 10869201 - 10869147
Alignment:
| Q |
32 |
tttactcaatacgtctaaaagtatatgttaatttagtacattacatatgaaataa |
86 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||||||||| ||||| ||||||||| |
|
|
| T |
10869201 |
tttactcaattcgtcaaaaactatatgttaatttagtacgttacacatgaaataa |
10869147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 72
Target Start/End: Complemental strand, 10866689 - 10866653
Alignment:
| Q |
36 |
ctcaatacgtctaaaagtatatgttaatttagtacat |
72 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
10866689 |
ctcaattcgtctaaaactatatgttaatttagtacat |
10866653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University