View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3252_high_19 (Length: 320)
Name: NF3252_high_19
Description: NF3252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3252_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 125 - 319
Target Start/End: Complemental strand, 2245279 - 2245084
Alignment:
| Q |
125 |
aatgtgtgtatgtatgggttgctgcaagtgataggataggtggggtgcatttatagttagcaacaa-gaagagcatagttgcttatcagacaacgaatcc |
223 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2245279 |
aatgtgtgaatgtatgggttgcagcaagtgataggataggtggggtgcatttatagttagcaacaaagaagagcatagttgcttatcagacaacgaatcc |
2245180 |
T |
 |
| Q |
224 |
cactccctattcacacgcacaactgggaaaacgtctcgattgtctttgtggattgacttaaatgactatagggtcctcgaccacgagacggttaat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2245179 |
cactccctattcacacgcacaactgggaaaacgtctcgattgtctttgtggattgacttaaatgactaaagggtcctcgaccacgagacggttaat |
2245084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 53 - 82
Target Start/End: Complemental strand, 2245343 - 2245314
Alignment:
| Q |
53 |
tggtgccttctttatgagttagtgaaggtt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2245343 |
tggtgccttctttatgagttagtgaaggtt |
2245314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University